GRIK1 (NM_175611) Human 3' UTR Clone

CAT#: SC204023

3' UTR clone of glutamate receptor ionotropic kainate 1 (GRIK1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GRIK1 (NM_175611) Human 3' UTR Clone
Vector pMirTarget
Synonyms EAA3; EEA3; GLR5; GluK1; gluR-5; GLUR5
ACCN NM_175611
Insert Size 327 bp
Sequence Data
>SC204023 3’UTR clone of NM_175611
The sequence shown below is from the reference sequence of NM_175611. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGAACTCAGAGAAAAGAGACTGTGGCGTGATCCAAGGAAACGCCTGTAGGAAGAAAAAGGATGCATTCC
CTACAGATTTTTGGAGAAAGGATTTCTGAGGAGTGTGTGATGTGTTTCCATATATCTATATCCATAACT
CTGATTATGAATACAGATATAAGAAATACAAAAGTTTAAAAAGCTCACATAGATATGACTTGGGAAGTG
ACACCAGTTCTTTTAAAATAAATTTGTATGCTCAATTATTTTGCATTTTTTCTTTTTCCCCAATAAATT
GTTGTGTGTGCTTTCTAAATAATAATAAAACAACAGGGTTTTTTTCCAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_175611.3
Synonyms EAA3; EEA3; GLR5; GluK1; gluR-5; GLUR5
Summary Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to alter the properties of ion flow. Alternative splicing, resulting in transcript variants encoding different isoforms, has been noted for this gene. [provided by RefSeq, Jul 2008]
Locus ID 2897
MW 12.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...