BCCIP (NM_078468) Human 3' UTR Clone

CAT#: SC203821

3' UTR clone of BRCA2 and CDKN1A interacting protein (BCCIP) transcript variant B for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name BCCIP (NM_078468) Human 3' UTR Clone
Vector pMirTarget
Synonyms TOK-1; TOK1
ACCN NM_078468
Insert Size 307 bp
Sequence Data
>SC203821 3’UTR clone of NM_078468
The sequence shown below is from the reference sequence of NM_078468. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATAAACTGAAAGAATATCTATCTGTCTAACCCATTTCCAATGGACAGTGATGGGCTTGTTTTTGTAAA
ATTACCAGAAAACTCAGTGGAGATTTACTGAAAAACTCAGACTTTATTCAGATTAAGTTCCTCTACAAA
AAGTAGGGTTCTGTCCCATGTGTCTCTGACACATTTACAAAATACCAGTTTTTTAAAATTTTGGTCAAA
TTATGAGTGGTTGATTTAAAAACTTTTCCAAGAAGAAGAAAAGCATGGAGTAGTAATTTAAAGAACTCA
ATAAAAACTTCTATTTTTTATTTTAAAATAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_078468.3
Synonyms TOK-1; TOK1
Summary This gene product was isolated on the basis of its interaction with BRCA2 and p21 proteins. It is an evolutionarily conserved nuclear protein with multiple interacting domains. The N-terminal half shares moderate homology with regions of calmodulin and M-calpain, suggesting that it may also bind calcium. Functional studies indicate that this protein may be an important cofactor for BRCA2 in tumor suppression, and a modulator of CDK2 kinase activity via p21. This protein has also been implicated in the regulation of BRCA2 and RAD51 nuclear focus formation, double-strand break-induced homologous recombination, and cell cycle progression. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Locus ID 56647
MW 12
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...