RGS10 (NM_001005339) Human 3' UTR Clone

CAT#: SC203796

3' UTR clone of regulator of G-protein signaling 10 (RGS10) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RGS10 (NM_001005339) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_001005339
Insert Size 326 bp
Sequence Data
>SC203796 3’UTR clone of NM_001005339
The sequence shown below is from the reference sequence of NM_001005339. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAAAGAGCTTCCAGAATTTATAACACATGAGCCCCCAAAAAGCCGGGACTGGCAGCTTTAAGAAGCAAA
GGAATTTCCTCTCAGGACCGTGCCGGGTTTATCATTGCTTTGTTATTTGTAAGGACTGAAATGTACAAA
ACCCTTCAATGGGATGTGTGTTTTATTAACTGCTTCACCAGTAAATTTTGCATGATGGCTAAGCTAACA
TAAAAAAAGAATAATAATAACTTGGAAGTTTTAGTTTACAAAACAGAGATTCCTTCAACACTGGACACG
TCGAGCATTTTGTAGCTTAATTAAACCTCATGTAAGGCCACAAGGTGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001005339.2
Summary Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 10 belongs to this family. All RGS proteins share a conserved 120-amino acid sequence termed the RGS domain. This protein associates specifically with the activated forms of the two related G-protein subunits, G-alphai3 and G-alphaz but fails to interact with the structurally and functionally distinct G-alpha subunits. Regulator of G protein signaling 10 protein is localized in the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 6001
MW 12.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...