delta Sarcoglycan (SGCD) (NM_172244) Human 3' UTR Clone

CAT#: SC203681

3' UTR clone of sarcoglycan delta (35kDa dystrophin-associated glycoprotein) (SGCD) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name delta Sarcoglycan (SGCD) (NM_172244) Human 3' UTR Clone
Vector pMirTarget
Synonyms 35DAG; CMD1L; DAGD; LGMDR6; SG-delta; SGCDP; SGD
ACCN NM_172244
Insert Size 313 bp
Sequence Data
>SC203681 3’UTR clone of NM_172244
The sequence shown below is from the reference sequence of NM_172244. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACAGGCCAACCCTTCCCATAACTGGTTGACCTCGGAGTTGGATCCTACAGTGTATCAACAAAAGGAGC
CAAGCAGGTTTTATTTCTGAAACAATTAATTGAGCAGCATGATTATAAGCCAAACCCACAATCCATCAA
AGTGATGATTTCTTATTTGTAAAATGCAGAGATAATGGCATGTATTCCAAGTACAGAATTATATGACCA
TGAAAATGAATGCTATTTTCAAATTCTCTCTTGTCACCTTAAAATAAGATTTTGTTAGCCAACATAATT
AAGCTGTATATATTATACACATCTGGCTCAAGATGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_172244.3
Synonyms 35DAG; CMD1L; DAGD; LGMDR6; SG-delta; SGCDP; SGD
Summary The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008]
Locus ID 6444
MW 11.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...