GPR172A (SLC52A2) (NM_024531) Human 3' UTR Clone

CAT#: SC203676

3' UTR clone of G protein-coupled receptor 172A (GPR172A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GPR172A (SLC52A2) (NM_024531) Human 3' UTR Clone
Vector pMirTarget
Synonyms BVVLS2; D15Ertd747e; GPCR41; GPR172A; hRFT3; PAR1; RFT3; RFVT2
ACCN NM_024531
Insert Size 287 bp
Sequence Data
>SC203676 3’UTR clone of NM_024531
The sequence shown below is from the reference sequence of NM_024531. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGGACTGTGCAGACCCCTGTGACTCCTGAGCCTGGGCAGGTGGGGACCCCGCTCCCCAACACCTGTCT
TTCCCTCAATGCTGCCACCATGCCTGAGTGCCTGCAGCCCAGGAGGCCCGCACACCGGTACACTCGTGG
ACACCTACACACTCCATAGGAGATCCTGGCTTTCCAGGGTGGGCAAGGGCAAGGAGCAGGCTTGGAGCC
AGGGACCAGTGGGGGCTGTAGGGTAAGCCCCTGAGCCTGGGACCTACATGTGGTTTGCGTAATAAAACA
TTTGTATTTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_024531.5
Synonyms BVVLS2; D15Ertd747e; GPCR41; GPR172A; hRFT3; PAR1; RFT3; RFVT2
Summary This gene encodes a membrane protein which belongs to the riboflavin transporter family. In humans, riboflavin must be obtained by intestinal absorption because it cannot be synthesized by the body. The water-soluble vitamin riboflavin is processed to the coenzymes flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) which then act as intermediaries in many cellular metabolic reactions. Paralogous members of the riboflavin transporter gene family are located on chromosomes 17 and 20. Unlike other members of this family, this gene has higher expression in brain tissue than small intestine. Alternative splicing of this gene results in multiple transcript variants encoding the same protein. Mutations in this gene have been associated with Brown-Vialetto-Van Laere syndrome 2 - an autosomal recessive progressive neurologic disorder characterized by deafness, bulbar dysfunction, and axial and limb hypotonia. [provided by RefSeq, Jul 2012]
Locus ID 79581
MW 10.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...