ADH1C (NM_000669) Human 3' UTR Clone

CAT#: SC203665

3' UTR clone of alcohol dehydrogenase 1C (class I) gamma polypeptide (ADH1C) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ADH1C (NM_000669) Human 3' UTR Clone
Vector pMirTarget
Synonyms ADH3
ACCN NM_000669
Insert Size 285 bp
Sequence Data
>SC203665 3’UTR clone of NM_000669
The sequence shown below is from the reference sequence of NM_000669. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGAGTATCCGTACCGTCCTGACGTTTTGAAACAATACAGATGCCTTCCCTTGTAGCAGTTTTCAGCCT
CCTCTACCCTACATGATCTGGAGCAACAGCTAGGAAATATCATTAATTCTGCTCTTCAGAGATGTTAAA
AATAAATTACACGTGGGAGCTTTCCAAAGAAATGGAAATTGATGGGAAATTATTTGTCAAGCAAATGTT
TAAAATCCAAATGAGAACTAAATAAAGTGTTGAACATCAACTGGGGAATTGAAGCCAATAAACCTTCCT
TCTTAACCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000669.5
Synonyms ADH3
Summary This gene encodes class I alcohol dehydrogenase, gamma subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class I alcohol dehydrogenase, consisting of several homo- and heterodimers of alpha, beta, and gamma subunits, exhibits high activity for ethanol oxidation to acetaldehyde, thus playing a major role in ethanol catabolism. Three genes encoding alpha, beta and gamma subunits are tandemly organized in a genomic segment as a gene cluster. An association between ADH1C polymorphism and alcohol dependence has not been established. [provided by RefSeq, Sep 2019]
Locus ID 126
MW 10.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...