USP21 (NM_001014443) Human 3' UTR Clone

CAT#: SC203638

3' UTR clone of ubiquitin specific peptidase 21 (USP21) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name USP21 (NM_001014443) Human 3' UTR Clone
Vector pMirTarget
Synonyms USP16; USP23
ACCN NM_001014443
Insert Size 306 bp
Sequence Data
>SC203638 3’UTR clone of NM_001014443
The sequence shown below is from the reference sequence of NM_001014443. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGATGCAGGAGCCACCCCGGTGCCTGTGACACCTCTAAGCTCTGGCACCTGTGAAGCCCTTTAAACAC
CCTTAAGCCCCAGGCTCCCCGTTTACCTCAGAGACGTCTATTTTTGTGTCTTTTTAATCGGGGAGGGGG
GAGGGGGTGGTTGTAGCTCCATTATTTTTTTTATTAAAAAATACCCTTCCACCTGGAGGCTCCCTTGTC
TCCCAGCCCCATGTACAAAGCTCACCAAGCCCCTGCCCATGTACAGCCCCCAGACCCTCTGCAATATCA
CTTTTTGTGAATAAATTTATTAAGAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001014443.3
Synonyms USP16; USP23
Summary This gene encodes a member of the C19 peptidase family, also known as family 2 of ubiquitin carboxy-terminal hydrolases. The encoded protein cleaves ubiquitin from ubiquitinated proteins for recycling in intracellular protein degradation. The encoded protein is also able to release NEDD8, a ubiquitin-like protein, from NEDD8-conjugated proteins. This gene has been referred to as USP16 and USP23 but is now known as USP21. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Locus ID 27005
MW 10.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...