Relaxin 1 (RLN1) (NM_006911) Human 3' UTR Clone

CAT#: SC203617

3' UTR clone of relaxin 1 (RLN1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Relaxin 1 (RLN1) (NM_006911) Human 3' UTR Clone
Vector pMirTarget
Synonyms bA12D24.3.1; bA12D24.3.2; H1; H1RLX; RLXH1
ACCN NM_006911
Insert Size 351 bp
Sequence Data
>SC203617 3’UTR clone of NM_006911
The sequence shown below is from the reference sequence of NM_006911. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCAAAAGGTCTCTTGCTAAATATTGCTGAGATGAAGCTAATTGTGCACATCTTGTCTAATTTTCACAC
ATAGTCTTGATGACATTTCACTGATGCTTCTGTCAGGTCCCACTAATTATTAGAATATAAGAAATCTTT
ATTAATGTTTAGATTTTTCATTTGGTGTGTAAGAAAATATTCTTTGTATGATTGTAGTTTCTGTAAATG
ACACTTTCTATGCTGAAGTCTTTTTGTCTTTTTATTAACAGTATAATTGTGTTGATTCTTTTTAATGCT
GTTAACTTAAAATTACAATAAAACCTTTGCCACTTTAACCATACATAATAACAATACAGTACCTAACAA
CAGTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006911.4
Synonyms bA12D24.3.1; bA12D24.3.2; H1; H1RLX; RLXH1
Summary Relaxins are known endocrine and autocrine/paracrine hormones, belonging to the insulin gene superfamily. In humans there are three non-allelic relaxin genes, RLN1, RLN2 and RLN3, where RLN1 and RLN2 share high sequence homology. The protein encoded by this gene is synthesized as a single-chain polypeptide but the active form consists of an A chain and a B chain linked by disulfide bonds. Relaxin is produced by the ovary, and targets the mammalian reproductive system to ripen the cervix, elongate the pubic symphysis and inhibit uterine contraction. It may have additional roles in enhancing sperm motility, regulating blood pressure, controlling heart rate and releasing oxytocin and vasopressin. [provided by RefSeq, Jan 2013]
Locus ID 6013
MW 13.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...