alpha 1 Antichymotrypsin (SERPINA3) (NM_001085) Human 3' UTR Clone

CAT#: SC203563

3' UTR clone of serpin peptidase inhibitor clade A (alpha-1 antiproteinase antitrypsin) member 3 (SERPINA3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name alpha 1 Antichymotrypsin (SERPINA3) (NM_001085) Human 3' UTR Clone
Vector pMirTarget
Synonyms AACT; ACT; GIG24; GIG25
ACCN NM_001085
Insert Size 269 bp
Sequence Data
>SC203563 3’UTR clone of NM_001085
The sequence shown below is from the reference sequence of NM_001085. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGCAAAGTCACCAATCCCAAGCAAGCCTAGAGCTTGCCATCAAGCAGTGGGGCTCTCAGTAAGGAACTT
GGAATGCAAGCTGGATGCCTGGGTCTCTGGGCACAGCCTGGCCCCTGTGCACCGAGTGGCCATGGCATG
TGTGGCCCTGTCTGCTTATCCTTGGAAGGTGACAGCGATTCCCTGTGTAGCTCTCACATGCACAGGGGC
CCATGGACTCTTCAGTCTGGAGGGTCCTGGGCCTCCTGACAGCAATAAATAATTTCGTTGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001085.5
Synonyms AACT; ACT; GIG24; GIG25
Summary The protein encoded by this gene is a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. This gene is one in a cluster of serpin genes located on the q arm of chromosome 14. Polymorphisms in this protein appear to be tissue specific and influence protease targeting. Variations in this protein's sequence have been implicated in Alzheimer's disease, and deficiency of this protein has been associated with liver disease. Mutations have been identified in patients with Parkinson disease and chronic obstructive pulmonary disease. [provided by RefSeq, Jun 2020]
Locus ID 12
MW 9.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...