SNURPORTIN1 (SNUPN) (NM_001042581) Human 3' UTR Clone

CAT#: SC203504

3' UTR clone of snurportin 1 (SNUPN) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SNURPORTIN1 (SNUPN) (NM_001042581) Human 3' UTR Clone
Vector pMirTarget
Synonyms KPNBL; RNUT1; Snurportin1
ACCN NM_001042581
Insert Size 302 bp
Sequence Data
>SC203504 3’UTR clone of NM_001042581
The sequence shown below is from the reference sequence of NM_001042581. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACCACCCTGGATGCCTCATGGAGAATTAAAGAGAGAAGCCTCCTTAAGGAGCCACAGGATGGTACCTG
GCCCCAAAAGGAATCCTGGAGAGGAGGACAGTGACAACAGGTGACTTCATTCTTTAGAGTGAACTTTCC
AAACCCAGTCCAGCTGGAAACAGCTTATCTATAATCTGAAATGCTGGCTCAAACAGTTATGGGGAGGTT
CCCAGATTGCGTAGCATTCAGATTGATTTGAGCAGCTCCTACTGTGATAAGTGTATCCCAGATCCACAA
TGTAAATATATGTGATTTGTAAGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001042581.2
Synonyms KPNBL; RNUT1; Snurportin1
Summary The nuclear import of the spliceosomal snRNPs U1, U2, U4 and U5, is dependent on the presence of a complex nuclear localization signal. The latter is composed of the 5'-2,2,7-terminal trimethylguanosine (m3G) cap structure of the U snRNA and the Sm core domain. The protein encoded by this gene interacts specifically with m3G-cap and functions as an snRNP-specific nuclear import receptor. Alternatively spliced transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Locus ID 10073
MW 11
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...