KLRC3 (NM_002261) Human 3' UTR Clone

CAT#: SC203488

3' UTR clone of killer cell lectin-like receptor subfamily C member 3 (KLRC3) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name KLRC3 (NM_002261) Human 3' UTR Clone
Vector pMirTarget
Synonyms NKG2-E; NKG2E
ACCN NM_002261
Insert Size 287 bp
Sequence Data
>SC203488 3’UTR clone of NM_002261
The sequence shown below is from the reference sequence of NM_002261. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGTTGACCAGGCTGGTCTTGAACTCCTGAGCTCAAGAAATCAACACATCTTGGCCTCCCAAGTTGCTG
GGATTACTGACACAAGCCACCGCCCCTGAGTGCTCATGTACCATTTAGCTTGTGTTTTAAAAATCTACT
TTTTCTGCCCTCCCTATTTTTAACTAGATGATGTTTTAAAAATTACTTTTCCCTCTCTATATAGTTTGA
TTTAAGCATTAGTCATTTACAACAAATATTAATATTAAAATGCAGACCGTTATGATTGGAAAATAAATC
AATGAACAATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002261.3
Synonyms NKG2-E; NKG2E
Summary Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. KLRC3 is a member of the NKG2 group which are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The NKG2 gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Locus ID 3823
MW 10.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...