Oct4 (POU5F1) (NM_002701) Human 3' UTR Clone

CAT#: SC203486

3' UTR clone of POU class 5 homeobox 1 (POU5F1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Oct4 (POU5F1) (NM_002701) Human 3' UTR Clone
Vector pMirTarget
Synonyms Oct-3; Oct-4; OCT3; OCT4; OTF-3; OTF3; OTF4
ACCN NM_002701
Insert Size 294 bp
Sequence Data
>SC203486 3’UTR clone of NM_002701
The sequence shown below is from the reference sequence of NM_002701. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTCTGGGCTCTCCCATGCATTCAAACTGAGGTGCCTGCCCTTCTAGGAATGGGGGACAGGGGGAGGGG
AGGAGCTAGGGAAAGAAAACCTGGAGTTTGTGCCAGGGTTTTTGGGATTAAGTTCTTCATTCACTAAGG
AAGGAATTGGGAACACAAAGGGTGGGGGCAGGGGAGTTTGGGGCAACTGGTTGGAGGGAAGGTGAAGTT
CAATGATGCTCTTGATTTTAATCCCACATCATGTATCACTTTTTTCTTAAATAAAGAAGCCTGGGACAC
AGTAGATAGACACACTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002701.6
Synonyms Oct-3; Oct-4; OCT3; OCT4; OTF-3; OTF3; OTF4
Summary This gene encodes a transcription factor containing a POU homeodomain that plays a key role in embryonic development and stem cell pluripotency. Aberrant expression of this gene in adult tissues is associated with tumorigenesis. This gene can participate in a translocation with the Ewing's sarcoma gene on chromosome 21, which also leads to tumor formation. Alternative splicing, as well as usage of alternative AUG and non-AUG translation initiation codons, results in multiple isoforms. One of the AUG start codons is polymorphic in human populations. Related pseudogenes have been identified on chromosomes 1, 3, 8, 10, and 12. [provided by RefSeq, Oct 2013]
Locus ID 5460
MW 10.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...