Dysferlin (DYSF) (NM_001130980) Human 3' UTR Clone

CAT#: SC203443

3' UTR clone of dysferlin limb girdle muscular dystrophy 2B (autosomal recessive) (DYSF) transcript variant 13 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Dysferlin (DYSF) (NM_001130980) Human 3' UTR Clone
Vector pMirTarget
Synonyms FER1L1; LGMD2B; LGMDR2; MMD1
ACCN NM_001130980
Insert Size 301 bp
Sequence Data
>SC203443 3’UTR clone of NM_001130980
The sequence shown below is from the reference sequence of NM_001130980. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCATGAAGCTGGTGAAGCCCTTCAGCTGAGGACTCTCCTGCCCTGTAGAAGGGGCCGTGGGGTCCCCT
CCAGCATGGGACTGGCCTGCCTCCTCCGCCCAGCTCGGCGAGCTCCTCCAGACCTCCTAGGCCTGATTG
TCCTGCCAGGGTGGGCAGACAGACAGATGGACCGGCCCACACTCCCAGAGTTGCTAACATGGAGCTCTG
AGATCACCCCACTTCCATCATTTCCTTCTCCCCCAACCCAACGCTTTTTTGGATCAGCTCAGACATATT
TCAGTATAAAACAGTTGGAACCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001130980.2
Synonyms FER1L1; LGMD2B; LGMDR2; MMD1
Summary The protein encoded by this gene belongs to the ferlin family and is a skeletal muscle protein found associated with the sarcolemma. It is involved in muscle contraction and contains C2 domains that play a role in calcium-mediated membrane fusion events, suggesting that it may be involved in membrane regeneration and repair. In addition, the protein encoded by this gene binds caveolin-3, a skeletal muscle membrane protein which is important in the formation of caveolae. Specific mutations in this gene have been shown to cause autosomal recessive limb girdle muscular dystrophy type 2B (LGMD2B) as well as Miyoshi myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2008]
Locus ID 8291
MW 10.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...