PPP1R16A (NM_032902) Human 3' UTR Clone

CAT#: SC203416

3' UTR clone of protein phosphatase 1 regulatory (inhibitor) subunit 16A (PPP1R16A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PPP1R16A (NM_032902) Human 3' UTR Clone
Vector pMirTarget
Synonyms MYPT3
ACCN NM_032902
Insert Size 248 bp
Sequence Data
>SC203416 3’UTR clone of NM_032902
The sequence shown below is from the reference sequence of NM_032902. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGAGGAGGCCGTGCTGCCTGCTCATGTGAGGCTGTTGCTCAGCATGCAGGGGCCCTGTCGCGGGCACA
GCCCAAGGCTGCCTCCCCACGGTGCGTGCCCTGGTGCTGCGGGTGCAGCACGGAAACCCCGGCTTCTAC
TGTACAGGACACTGGCCCCTCTCAGGTCAGAAGACATGCCTGGAGGGATGTCTGGCTGCAAAGACTATT
TTTATCCTGCAACTCTTGATAAAGGGCTGTTTTGCCATGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032902.7
Synonyms MYPT3
Summary Myosin light chain kinase and phosphatase (MLCP) complexes control the phosphorylation states of regulatory myosin light chains, which is crucial for muscle and intracellular movement. MLCPs typically contain a catalytic protein phosphatase 1 (PP1c) subunit, a myosin phosphatase targeting (MYPT) subunit, and another smaller subunit. The protein encoded by this gene represents an MYPT subunit, which is responsible for directing PP1c to its intended targets. However, while the phosphorylation of other MYPT members results in PP1c inactivation, phosphorylation of the encoded protein by protein kinase A results in PP1c activation. [provided by RefSeq, Jan 2020]
Locus ID 84988
MW 8.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...