Gelsolin (GSN) (NM_001127664) Human 3' UTR Clone

CAT#: SC203404

3' UTR clone of gelsolin (amyloidosis Finnish type) (GSN) transcript variant 5 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Gelsolin (GSN) (NM_001127664) Human 3' UTR Clone
Vector pMirTarget
Synonyms ADF; AGEL
ACCN NM_001127664
Insert Size 269 bp
Sequence Data
>SC203404 3’UTR clone of NM_001127664
The sequence shown below is from the reference sequence of NM_001127664. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACAGGGCCATGGCTGAGCTGGCTGCCTGAGGAGGGGCAGGGCCCACCCATGTCACCGGTCAGTGCCTT
TTGGAACTGTCCTTCCCTCAAAGAGGCCTTAGAGCGAGCAGAGCAGCTCTGCTATGAGTGTGTGTGTGT
GTGTGTGTTGTTTCTTTTTTTTTTTTTTACAGTATCCAAAAATAGCCCTGCAAAAATTCAGAGTCCTTG
CAAAATTGTCTAAAATGTCAGTGTTTGGGAAATTAAATCCAATAAAAACATTTTGAAGTGTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001127664.2
Synonyms ADF; AGEL
Summary The protein encoded by this gene binds to the "plus" ends of actin monomers and filaments to prevent monomer exchange. The encoded calcium-regulated protein functions in both assembly and disassembly of actin filaments. Defects in this gene are a cause of familial amyloidosis Finnish type (FAF). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 2934
MW 9.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...