Neuroserpin (SERPINI1) (NM_005025) Human 3' UTR Clone

CAT#: SC203340

3' UTR clone of serpin peptidase inhibitor clade I (neuroserpin) member 1 (SERPINI1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Neuroserpin (SERPINI1) (NM_005025) Human 3' UTR Clone
Vector pMirTarget
Synonyms HNS-S1; HNS-S2; neuroserpin; PI12
ACCN NM_005025
Insert Size 276 bp
Sequence Data
>SC203340 3’UTR clone of NM_005025
The sequence shown below is from the reference sequence of NM_005025. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACAAGTGGACATGATTTCGAAGAACTTTAAGTTACTTTATTTGAATAACAAGGAAAACAGTAACTAAGC
ACATTATGTTTGCAACTGGTATATATTTAGGATTTGTGTTTTACAGTATATCTTAAGATAATATTTAAA
ATAGTTCCAGATAAAAACAATATATGTAAATTATAAGTAACTTGTCAAGGAATGTTATCAGTATTAAGC
TAATGGTCCTGTTATGTCATTGTGTTTGTGTGCTGTTGTTTAAAATAAAAGTACCTATTGAACATGTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005025.5
Synonyms HNS-S1; HNS-S2; neuroserpin; PI12
Summary This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The protein is primarily secreted by axons in the brain, and preferentially reacts with and inhibits tissue-type plasminogen activator. It is thought to play a role in the regulation of axonal growth and the development of synaptic plasticity. Mutations in this gene result in familial encephalopathy with neuroserpin inclusion bodies (FENIB), which is a dominantly inherited form of familial encephalopathy and epilepsy characterized by the accumulation of mutant neuroserpin polymers. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Locus ID 5274
MW 10.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...