Plasma Kallikrein 1B (KLKB1) (NM_000892) Human 3' UTR Clone

CAT#: SC203315

3' UTR clone of kallikrein B plasma (Fletcher factor) 1 (KLKB1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Plasma Kallikrein 1B (KLKB1) (NM_000892) Human 3' UTR Clone
Vector pMirTarget
Synonyms KLK3; PKK; PKKD; PPK
ACCN NM_000892
Insert Size 289 bp
Sequence Data
>SC203315 3’UTR clone of NM_000892
The sequence shown below is from the reference sequence of NM_000892. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGAAAAGCTCAGATGCAGTCACCAGCATGAGAAGCAGTCCAGAGTCTAGGCAATTTTTACAACCTGAGT
TCAAGTCAAATTCTGAGCCTGGGGGGTCCTCATCTGCAAAGCATGGAGAGTGGCATCTTCTTTGCATCC
TAAGGACGAAAAACACAGTGCACTCAGAGCTGCTGAGGACAATGTCTGGCTGAAGCCCGCTTTCAGCAC
GCCGTAACCAGGGGCTGACAATGCGAGGTCGCAACTGAGATCTCCATGACTGTGTGTTGTGAAATAAAA
TGGTGAAAGATCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000892.5
Synonyms KLK3; PKK; PKKD; PPK
Summary This gene encodes a glycoprotein that participates in the surface-dependent activation of blood coagulation, fibrinolysis, kinin generation and inflammation. The encoded preproprotein present in plasma as a non-covalent complex with high molecular weight kininogen undergoes proteolytic processing mediated by activated coagulation factor XII to generate a disulfide-linked, heterodimeric serine protease comprised of heavy and light chains. Certain mutations in this gene cause prekallikrein deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Locus ID 3818
MW 10.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...