GRP94 (HSP90B1) (NM_003299) Human 3' UTR Clone

CAT#: SC203308

3' UTR clone of heat shock protein 90kDa beta (Grp94) member 1 (HSP90B1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GRP94 (HSP90B1) (NM_003299) Human 3' UTR Clone
Vector pMirTarget
Synonyms ECGP; GP96; GRP94; HEL-S-125m; HEL35; TRA1
ACCN NM_003299
Insert Size 294 bp
Sequence Data
>SC203308 3’UTR clone of NM_003299
The sequence shown below is from the reference sequence of NM_003299. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAATCTACAGCTGAAAAAGATGAATTGTAAATTATACTCTCACCATTTGGATCCTGTGTGGAGAGGGAA
TGTGAAATTTACATCATTTCTTTTTGGGAGAGACTTGTTTTGGATGCCCCCTAATCCCCTTCTCCCCTG
CACTGTAAAATGTGGGATTATGGGTCACAGGAAAAAGTGGGTTTTTTAGTTGAATTTTTTTTAACATTC
CTCATGAATGTAAATTTGTACTATTTAACTGACTATTCTTGATGTAAAATCTTGTCATGTGTATAAAAA
TAAAAAAGATCCCAAATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003299.3
Synonyms ECGP; GP96; GRP94; HEL-S-125m; HEL35; TRA1
Summary This gene encodes a member of a family of adenosine triphosphate(ATP)-metabolizing molecular chaperones with roles in stabilizing and folding other proteins. The encoded protein is localized to melanosomes and the endoplasmic reticulum. Expression of this protein is associated with a variety of pathogenic states, including tumor formation. There is a microRNA gene located within the 5' exon of this gene. There are pseudogenes for this gene on chromosomes 1 and 15. [provided by RefSeq, Aug 2012]
Locus ID 7184
MW 11.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...