TCP1 beta (CCT2) (NM_006431) Human 3' UTR Clone

CAT#: SC203261

3' UTR clone of chaperonin containing TCP1 subunit 2 (beta) (CCT2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name TCP1 beta (CCT2) (NM_006431) Human 3' UTR Clone
Vector pMirTarget
Synonyms 99D8.1; CCT-beta; CCTB; HEL-S-100n; PRO1633; TCP-1-beta
ACCN NM_006431
Insert Size 275 bp
Sequence Data
>SC203261 3’UTR clone of NM_006431
The sequence shown below is from the reference sequence of NM_006431. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAACGTGTCCCTGATCACCACCCCTGTTAAGCATTCCCACGTGCTGTCGATCTTTGGACCAGTTTCTAG
CAAAGTTGTGTTTGAAAGATACTCTATTAAAGAAGACTGTGGAATCTGTTTATCGGTGCCCATTATATC
CTTAAGTTTGGATATTTAGCTGACCTTCGCTTTAACATAGGTCTAATTTATTTGCCGTGTCATTTTCCA
TACAAATCAGTTGATTTAAAAAAGTTCATTTCTCATACTGTGCATTAAAATAAAAATTTGAACAATTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006431.3
Synonyms 99D8.1; CCT-beta; CCTB; HEL-S-100n; PRO1633; TCP-1-beta
Summary The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Locus ID 10576
MW 10.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...