NALP2 (NLRP2) (NM_017852) Human 3' UTR Clone

CAT#: SC203243

3' UTR clone of NLR family pyrin domain containing 2 (NLRP2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NALP2 (NLRP2) (NM_017852) Human 3' UTR Clone
Vector pMirTarget
Synonyms CLR19.9; NALP2; NBS1; PAN1; PYPAF2
ACCN NM_017852
Insert Size 270 bp
Sequence Data
>SC203243 3’UTR clone of NM_017852
The sequence shown below is from the reference sequence of NM_017852. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGCCTTCTTCTCATGACTTCATGATCTGAATCCCCCCGAGTCATTCATTCTCCATGAAGTCATCGATT
TTCCAGGTGTTGGTGAACTGCCTGTGACTCCTCTCCTCCCCGGCCCCTACCCCTCAGGGATAATGAGTT
CATTGCTGGGCTAGATGTTTTAGCCATGATTCTGCCTCTGTTTTATACCTGCACACATCCTTATCTTTG
TTACATATGAAATATCTGTATCACGGGTATATTGAGAGAAATAAAGGTGAGAGCATTCACAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_017852.5
Synonyms CLR19.9; NALP2; NBS1; PAN1; PYPAF2
Summary This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Locus ID 55655
MW 10.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...