NUDT2 (NM_001161) Human 3' UTR Clone

CAT#: SC203207

3' UTR clone of nudix (nucleoside diphosphate linked moiety X)-type motif 2 (NUDT2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NUDT2 (NM_001161) Human 3' UTR Clone
Vector pMirTarget
Synonyms APAH1
ACCN NM_001161
Insert Size 289 bp
Sequence Data
>SC203207 3’UTR clone of NM_001161
The sequence shown below is from the reference sequence of NM_001161. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACCAGTTTCTTTGCTCCATAGAGGCCTGAGCTGACTGGAGCAGAGTCATTTGCTTCAGCAGGATCCTT
GTGGGCCTTCTAAGATGAAGCCACCCTCAGGTCCAGGGAAGGTTGTGCTGGTATTTGGCTCATGACAGC
CAAGAGCAGATTTGTGAAATCGGCTCAACTCCCAGGTGAGAGCAAGCAAAAATCTTGGCTGGGTGGAAA
GGAAGGCAAAAGAGTAAAAATTAAAAAGGCCAGGCCCAGTAAGTGTACCTTGTACTTTATAAATAAACC
TCAAGCAGCTCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001161.5
Synonyms APAH1
Summary This gene encodes a member of the MutT family of nucleotide pyrophosphatases, a subset of the larger NUDIX hydrolase family. The gene product possesses a modification of the MutT sequence motif found in certain nucleotide pyrophosphatases. The enzyme asymmetrically hydrolyzes Ap4A to yield AMP and ATP and is responsible for maintaining the intracellular level of the dinucleotide Ap4A, the function of which has yet to be established. This gene may be a candidate tumor suppressor gene. Alternative splicing has been observed at this locus and four transcript variants, all encoding the same protein, have been identified. [provided by RefSeq, Sep 2011]
Locus ID 318
MW 10.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...