Alcohol Dehydrogenase (ADH1A) (NM_000667) Human 3' UTR Clone

CAT#: SC203195

3' UTR clone of alcohol dehydrogenase 1A (class I) alpha polypeptide (ADH1A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Alcohol Dehydrogenase (ADH1A) (NM_000667) Human 3' UTR Clone
Vector pMirTarget
Synonyms ADH1
ACCN NM_000667
Insert Size 285 bp
Sequence Data
>SC203195 3’UTR clone of NM_000667
The sequence shown below is from the reference sequence of NM_000667. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAAAGTATCCGTACCATTCTGATGTTTTGAGACAATACAGATGTTTTCCCTTGTGGCAGTCTTCAGCCT
CCTCTACCCTACATGATCTGGAGCAACAGCTGGGAAATATCATTAATTCTGCTCATCACAGATTTTATC
AATAAATTACATTTGGGGGCTTTCCAAAGAAATGGAAATTGATGTAAAATTATTTTTCAAGCAAATGTT
TAAAATCCAAATGAGAACTAAATAAAGTGTTGAACATCAGCTGGGGAATTGAAGCCAATAAACCTTCCT
TCTTAACCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000667.4
Synonyms ADH1
Summary This gene encodes a member of the alcohol dehydrogenase family. The encoded protein is the alpha subunit of class I alcohol dehydrogenase, which consists of several homo- and heterodimers of alpha, beta and gamma subunits. Alcohol dehydrogenases catalyze the oxidation of alcohols to aldehydes. This gene is active in the liver in early fetal life but only weakly active in adult liver. This gene is found in a cluster with six additional alcohol dehydrogenase genes, including those encoding the beta and gamma subunits, on the long arm of chromosome 4. Mutations in this gene may contribute to variation in certain personality traits and substance dependence. [provided by RefSeq, Nov 2010]
Locus ID 124
MW 10.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...