IFITM2 (NM_006435) Human 3' UTR Clone

CAT#: SC203143

3' UTR clone of interferon induced transmembrane protein 2 (1-8D) (IFITM2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name IFITM2 (NM_006435) Human 3' UTR Clone
Vector pMirTarget
Synonyms 1-8D; DSPA2c
ACCN NM_006435
Insert Size 260 bp
Sequence Data
>SC203143 3’UTR clone of NM_006435
The sequence shown below is from the reference sequence of NM_006435. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCAGTGTTGGTCGTCCAGGCCCAGCGATAGATCAGGAGGCATCATTGAGGCCAGGAGCTCTGCCCGTGA
CCTGTATCCCACGTACTCTATCTTCCATTCCTCGCCCTGCCCCCAGAGGCCAGGAGCTCTGCCCTTGAC
CTGTATTCCACTTACTCCACCTTCCATTCCTCGCCCTGTCCCCACAGCCGAGTCCTGCATCAGCCCTTT
ATCCTCACACGCTTTTCTACAATGGCATTCAATAAAGTGTATATGTTTCTGGT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006435.3
Synonyms 1-8D; DSPA2c
Summary IFN-induced antiviral protein which inhibits the entry of viruses to the host cell cytoplasm, permitting endocytosis, but preventing subsequent viral fusion and release of viral contents into the cytosol. Active against multiple viruses, including influenza A virus, SARS coronavirus (SARS-CoV), Marburg virus (MARV), Ebola virus (EBOV), Dengue virus (DNV), West Nile virus (WNV), human immunodeficiency virus type 1 (HIV-1) and vesicular stomatitis virus (VSV). Can inhibit: influenza virus hemagglutinin protein-mediated viral entry, MARV and EBOV GP1,2-mediated viral entry, SARS-CoV S protein-mediated viral entry and VSV G protein-mediated viral entry. Induces cell cycle arrest and mediates apoptosis by caspase activation and in p53-independent manner.[UniProtKB/Swiss-Prot Function]
Locus ID 10581
MW 9.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...