GCKR (NM_001486) Human 3' UTR Clone

CAT#: SC203128

3' UTR clone of glucokinase (hexokinase 4) regulator (GCKR) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GCKR (NM_001486) Human 3' UTR Clone
Vector pMirTarget
Synonyms FGQTL5; GKRP
ACCN NM_001486
Insert Size 275 bp
Sequence Data
>SC203128 3’UTR clone of NM_001486
The sequence shown below is from the reference sequence of NM_001486. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCGAGATCCTAGAGCCTGACGTTCAGTGAACCCATGTTTCTGGGTGGGTGAAAGGGGCCCAACCCTGC
CCACTTCAGCCCAGCCCGCCCAAGGGGACTTGTGCCAGCAGAACATGTGGGAGGAAGAAGCCCCGTTTC
CAGGGCATCCGCAGCCCAGGGTAGGGAGAAATATTCTCTCCACTTTGGGGGAGAGTTCTTGCTCTCGAC
CTAGTGGTTTCTACTCTCACCGACTTATTCTGATTTCAGAAATAAAATGAAATGTCTTATTTTGGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001486.4
Synonyms FGQTL5; GKRP
Summary This gene encodes a protein belonging to the GCKR subfamily of the SIS (Sugar ISomerase) family of proteins. The gene product is a regulatory protein that inhibits glucokinase in liver and pancreatic islet cells by binding non-covalently to form an inactive complex with the enzyme. This gene is considered a susceptibility gene candidate for a form of maturity-onset diabetes of the young (MODY). [provided by RefSeq, Jul 2008]
Locus ID 2646
MW 10
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...