TBCA (NM_004607) Human 3' UTR Clone

CAT#: SC203047

3' UTR clone of tubulin folding cofactor A (TBCA) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name TBCA (NM_004607) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_004607
Insert Size 282 bp
Sequence Data
>SC203047 3’UTR clone of NM_004607
The sequence shown below is from the reference sequence of NM_004607. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTACTGGATTCAGTGAAGTTAGAAGCCTGAAACTTTTCTCGTATGGGGTGGTTTTTGCATTAAATCCTG
GGGTCCATTTTACAATCCATTATTTTTGACCACTGCTATGTGTTCAAGTAGTATGAGAATGTGATTGTT
TTTATCTGGTTACATATATATTTCTTTGTCTAATTTAATATGTCAAATAAATGAGTTCATCTAATAAAA
TTGTTTATTTTATACTTTACAAAATTTTTAAATTAACCTTTTATCATTAAACCACATAGACTTTATGAC
AGAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004607.3
Summary The product of this gene is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. This gene encodes chaperonin cofactor A. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Locus ID 6902
MW 11.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...