CDCP1 (NM_178181) Human 3' UTR Clone

CAT#: SC202957

3' UTR clone of CUB domain containing protein 1 (CDCP1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CDCP1 (NM_178181) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD318; SIMA135; TRASK
ACCN NM_178181
Insert Size 275 bp
Sequence Data
>SC202957 3’UTR clone of NM_178181
The sequence shown below is from the reference sequence of NM_178181. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAACATCCACAAAATGAAAGCAGTGAGTGAGCCCCACTTTCCTTTTTCTTCCTCCTCCAGCACCTTCGT
TGTTTCCTGGGTAGTCTGCCTGGGTGAGGCTCCCTTCCTGTTTCTCATCTGTGGCTTCTGAAACACTTA
GACTCTGGACCCAGCAAGAGTTTCAGGAAGTGGGTTGCTAGGCAGTTAGACAGGCTTGTTGGTGAACAC
CCGGTATGTAGTTCCATTTCAGCACAATAAAAAGAAATCTTGCATTCAAGATGCTAAATTGTTTTTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_178181.3
Synonyms CD318; SIMA135; TRASK
Summary This gene encodes a transmembrane protein which contains three extracellular CUB domains and acts as a substrate for Src family kinases. The protein plays a role in the tyrosine phosphorylation-dependent regulation of cellular events that are involved in tumor invasion and metastasis. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Locus ID 64866
MW 10.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...