Selenoprotein M (SELENOM) (NM_080430) Human 3' UTR Clone

CAT#: SC202923

3' UTR clone of selenoprotein M (SELM) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Selenoprotein M (SELENOM) (NM_080430) Human 3' UTR Clone
Vector pMirTarget
Synonyms SELM; SEPM
ACCN NM_080430
Insert Size 223 bp
Sequence Data
>SC202923 3’UTR clone of NM_080430
The sequence shown below is from the reference sequence of NM_080430. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGAAACTTCGGACCACGCTGACCTGTAGGTCCGGGGGCGCGGCGGAGCTGGGACCTACCTGCCTGAG
TCCTGGAGACAGAATGAAGCGCTCAGCATCCCGGGAATACTTCTCTTGCTGAGAGCCGATGCCCGTCCC
CGGGCCAGCAGGGATGGGGTTGGGGAGGTTCTCCCAACCCCACTTTCTTCCTTCCCCAGCTCCACTAAA
TTCCCTCCTGCCTTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_080430.4
Synonyms SELM; SEPM
Summary The protein encoded by this gene belongs to the selenoprotein M/SEP15 family. The exact function of this protein is not known. It is localized in the perinuclear region, is highly expressed in the brain, and may be involved in neurodegenerative disorders. Transgenic mice with targeted deletion of this gene exhibit increased weight gain, suggesting a role for this gene in the regulation of body weight and energy metabolism. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. [provided by RefSeq, Dec 2016]
Locus ID 140606
MW 7.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...