AATF (NM_012138) Human 3' UTR Clone

CAT#: SC202873

3' UTR clone of apoptosis antagonizing transcription factor (AATF) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name AATF (NM_012138) Human 3' UTR Clone
Vector pMirTarget
Synonyms BFR2; CHE-1; CHE1; DED
ACCN NM_012138
Insert Size 237 bp
Sequence Data
>SC202873 3’UTR clone of NM_012138
The sequence shown below is from the reference sequence of NM_012138. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACCCTCCCGACGAAGGCCACGGGGATTGACATCGCCCACCTCCGACACCCAGTGGGCGCCTTGGCTGG
TGCGGCTGCTGGTCCAGATGGAGGAAACCAGTGACTTTATGGGGCTGAGCTAGTAGGGAAGCCCCTGGA
AAGATGCTGCGTTCCGAACCTGTGCCTAATACACGCAAGGGCGCTGTCCCGCCCAACCCCGCCTTTAAA
CGCCACAAATAAAGAGCATTGTTACCGCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012138.4
Synonyms BFR2; CHE-1; CHE1; DED
Summary The protein encoded by this gene was identified on the basis of its interaction with MAP3K12/DLK, a protein kinase known to be involved in the induction of cell apoptosis. This gene product contains a leucine zipper, which is a characteristic motif of transcription factors, and was shown to exhibit strong transactivation activity when fused to Gal4 DNA binding domain. Overexpression of this gene interfered with MAP3K12 induced apoptosis. [provided by RefSeq, Jul 2008]
Locus ID 26574
MW 8.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...