GET3 (NM_004317) Human 3' UTR Clone

CAT#: SC202855

3' UTR clone of arsA arsenite transporter ATP-binding homolog 1 (bacterial) (ASNA1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GET3 (NM_004317) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARSA-I; ARSA1; ASNA-I; ASNA1; TRC40
ACCN NM_004317
Insert Size 249 bp
Sequence Data
>SC202855 3’UTR clone of NM_004317
The sequence shown below is from the reference sequence of NM_004317. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGCCCTACAAGCCCCCCAGTGCCCAGTAGCACAGCTGCCAGCCCCAACCGCTGCCATTTCACACTCAC
CCTCCACCCTCCCCACCCCCTCGGGGCAGAGTTTGCACAAAGTCCCCCCCATAATACAGGGGGAGCCAC
TTGGGCAGGAGGCAGGGAGGGGTCCATTCCCCCTGGTGGGGCTGGTGGGGAGCTGTAGTTGCCCCCTAC
CTCTCCCACCTCTTGCTCTTCAATAAAATGATCTTAAACTGC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004317.4
Synonyms ARSA-I; ARSA1; ASNA-I; ASNA1; TRC40
Summary This gene represents the human homolog of the bacterial arsA gene, encoding the arsenite-stimulated ATPase component of the arsenite transporter responsible for resistance to arsenicals. This protein is also a central component of a transmembrane domain (TMD) recognition complex (TRC) that is involved in the post-translational delivery of tail-anchored (TA) proteins from the cytosol to the endoplasmic reticulum (ER). It recognizes and selectively binds the TMD of TA proteins in the cytosol, and delivers them to the ER for insertion. [provided by RefSeq, Oct 2011]
Locus ID 439
MW 9.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...