GC1q R (C1QBP) (NM_001212) Human 3' UTR Clone

CAT#: SC202835

3' UTR clone of complement component 1 q subcomponent binding protein (C1QBP) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GC1q R (C1QBP) (NM_001212) Human 3' UTR Clone
Vector pMirTarget
Synonyms COXPD33; gC1Q-R; GC1QBP; gC1qR; HABP1; p32; SF2AP32; SF2p32
ACCN NM_001212
Insert Size 268 bp
Sequence Data
>SC202835 3’UTR clone of NM_001212
The sequence shown below is from the reference sequence of NM_001212. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACCTCAAGAGTTTTGTCAAGAGCCAGTAGAGCAGACAGATGCTGAAAGCCATAGTTTCATGGCAGGCT
TTGGCCAGTGAACAAATCCTACTCTGAAGCTAGACATGTGCTTTGAAATGATTATCATCCTAATATCAT
GGGGGAAAAAATACCAAATTTAAATTATATGTTTTGTGTTCTCATTTATTATCATTTTTTTCTGTACAA
ATCTATTATTTCTAGATTTTTGTATAACATGATAGACATAAAATTGGTTTATCTCCTCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001212.4
Synonyms COXPD33; gC1Q-R; GC1QBP; gC1qR; HABP1; p32; SF2AP32; SF2p32
Summary The human complement subcomponent C1q associates with C1r and C1s in order to yield the first component of the serum complement system. The protein encoded by this gene is known to bind to the globular heads of C1q molecules and inhibit C1 activation. This protein has also been identified as the p32 subunit of pre-mRNA splicing factor SF2, as well as a hyaluronic acid-binding protein. [provided by RefSeq, Jul 2008]
Locus ID 708
MW 10.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...