TLR1 (NM_003263) Human 3' UTR Clone

CAT#: SC202772

3' UTR clone of toll-like receptor 1 (TLR1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name TLR1 (NM_003263) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD281; rsc786; TIL; TIL. LPRS5
ACCN NM_003263
Insert Size 246 bp
Sequence Data
>SC202772 3’UTR clone of NM_003263
The sequence shown below is from the reference sequence of NM_003263. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATTAAGCTGACAGAGCAAGCAAAGAAATAGATTACACATCAAGTGAAAAATATTCCTCCTGTTGATATT
GCTGCTTTTGGAAGTTCCAACAATGACTTTATTTTGCATCAGCATAGATGTAAACACAATTGTGAGTGT
ATGATGTAGGTAAAAATATATACCTTCGGGTCGCAGTTCACCATTTATATGTGGTATTAAAAATTAATG
AAATGATATAACTTTGATTTAAACAGTTCTGACACATAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003263.4
Synonyms CD281; rsc786; TIL; TIL. LPRS5
Summary The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene. [provided by RefSeq, Jul 2008]
Locus ID 7096
MW 9.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...