RAD54B (NM_012415) Human 3' UTR Clone

CAT#: SC202665

3' UTR clone of RAD54 homolog B (S. cerevisiae) (RAD54B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RAD54B (NM_012415) Human 3' UTR Clone
Vector pMirTarget
Synonyms RDH54
ACCN NM_012415
Insert Size 240 bp
Sequence Data
>SC202665 3’UTR clone of NM_012415
The sequence shown below is from the reference sequence of NM_012415. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AATATAACCACTCAAGCTACTGGCACATAGTGAAAGATTACTTCTGACATTCCATTGCTCTTCTTTTGA
AAATTAGTATGGTAATTAAATGTACTTTTTGAAAATTAATAGAATTATTTAAATTACAGTATATGTTGC
AAAATATATCACTTTTGATACAATAGTCAAAATTGAGTGGTTTAATGTTTTGTAAATATTAAGTGTTTA
AATGAAAAATAAAGATGTGCTTATATCATTGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012415.3
Synonyms RDH54
Summary The protein encoded by this gene belongs to the DEAD-like helicase superfamily. It shares similarity with Saccharomyces cerevisiae RAD54 and RDH54, both of which are involved in homologous recombination and repair of DNA. This protein binds to double-stranded DNA, and displays ATPase activity in the presence of DNA. This gene is highly expressed in testis and spleen, which suggests active roles in meiotic and mitotic recombination. Homozygous mutations of this gene were observed in primary lymphoma and colon cancer. [provided by RefSeq, Jul 2008]
Locus ID 25788
MW 9.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...