Cyclophilin B (PPIB) (NM_000942) Human 3' UTR Clone

CAT#: SC202660

3' UTR clone of peptidylprolyl isomerase B (cyclophilin B) (PPIB) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Cyclophilin B (PPIB) (NM_000942) Human 3' UTR Clone
Vector pMirTarget
Synonyms B; CYP-S1; CYPB; HEL-S-39; OI9; SCYLP
ACCN NM_000942
Insert Size 236 bp
Sequence Data
>SC202660 3’UTR clone of NM_000942
The sequence shown below is from the reference sequence of NM_000942. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGAAGCCCTTTGCCATCGCCAAGGAGTAGGGCACAGGGACATCTTTCTTTGAGTGACCGTCTGTGCAG
GCCCTGTAGTCCGCCACAGGGCTCTGAGCTGCACTGGCCCCGGTGCTGGCATCTGGTGGAGCGGACCCA
CTCCCCTCACATTCCACAGGCCCATGGACTCACTTTTGTAACAAACTCCTACCAACACTGACCAATAAA
AAAAAATGTGGGTTTTTTTTTTTTTAATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000942.5
Synonyms B; CYP-S1; CYPB; HEL-S-39; OI9; SCYLP
Summary The protein encoded by this gene is a cyclosporine-binding protein and is mainly located within the endoplasmic reticulum. It is associated with the secretory pathway and released in biological fluids. This protein can bind to cells derived from T- and B-lymphocytes, and may regulate cyclosporine A-mediated immunosuppression. Variants have been identified in this protein that give rise to recessive forms of osteogenesis imperfecta. [provided by RefSeq, Oct 2009]
Locus ID 5479
MW 8.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...