Deoxyguanosine kinase (DGUOK) (NM_080918) Human 3' UTR Clone

CAT#: SC202656

3' UTR clone of deoxyguanosine kinase (DGUOK) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Deoxyguanosine kinase (DGUOK) (NM_080918) Human 3' UTR Clone
Vector pMirTarget
Synonyms dGK; MTDPS3; NCPH; PEOB4
ACCN NM_080918
Insert Size 240 bp
Sequence Data
>SC202656 3’UTR clone of NM_080918
The sequence shown below is from the reference sequence of NM_080918. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGTAAACACCTTTGTAAAGAATCTGTAACCAATACCATGAAGTTCAGGCTGTGATCTGGGCTCCCTG
ACTTTCTGAAGCTAGAAAAATGTTGTGTCTCCCAACCACCTTTCCATCCCCAGCCCCTCTCATCCCTGG
AGCACTCTGCCGCTCAAGAGCTGGTTTGTTAATTATTGTTAGACTTTGCCATTGTTTTCTTTTGTACCT
GAAGCATTTTGAAAATAAAGTTTACTTAAGTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_080918.3
Synonyms dGK; MTDPS3; NCPH; PEOB4
Summary In mammalian cells, the phosphorylation of purine deoxyribonucleosides is mediated predominantly by two deoxyribonucleoside kinases, cytosolic deoxycytidine kinase and mitochondrial deoxyguanosine kinase. The protein encoded by this gene is responsible for phosphorylation of purine deoxyribonucleosides in the mitochondrial matrix. In addition, this protein phosphorylates several purine deoxyribonucleoside analogs used in the treatment of lymphoproliferative disorders, and this phosphorylation is critical for the effectiveness of the analogs. Alternative splice variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Locus ID 1716
MW 8.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...