CD200R (CD200R1) (NM_138940) Human 3' UTR Clone

CAT#: SC202654

3' UTR clone of CD200 receptor 1 (CD200R1) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CD200R (CD200R1) (NM_138940) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD200R; HCRTR2; MOX2R; OX2R
ACCN NM_138940
Insert Size 255 bp
Sequence Data
>SC202654 3’UTR clone of NM_138940
The sequence shown below is from the reference sequence of NM_138940. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTGAGGTATTTCACATCACCAGATTTGTGACGGAAACAAATGTCTCTCTGAATTCCATATGCTTTATGT
GAAAACCGAAGCATTTTTTTCCCTCTTTCCTCTCTGCAGTTACACCTGAAGTGACCCTGTTTCAAAACA
GGAATAGAACTGCAGTATGCAAGGCAGTTGCAGGGAAGCCAGCTGCGCATATCTCCTGGATCCCAGAGG
GCGATTGTGCCACTAAGCAAGAATACTGGAGCAATGGCACAGTGACTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_138940.3
Synonyms CD200R; HCRTR2; MOX2R; OX2R
Summary This gene encodes a receptor for the OX-2 membrane glycoprotein. Both the receptor and substrate are cell surface glycoproteins containing two immunoglobulin-like domains. This receptor is restricted to the surfaces of myeloid lineage cells and the receptor-substrate interaction may function as a myeloid downregulatory signal. Mouse studies of a related gene suggest that this interaction may control myeloid function in a tissue-specific manner. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Locus ID 131450
MW 9.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...