NTE (PNPLA6) (NM_001166111) Human 3' UTR Clone

CAT#: SC202618

3' UTR clone of patatin-like phospholipase domain containing 6 (PNPLA6) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NTE (PNPLA6) (NM_001166111) Human 3' UTR Clone
Vector pMirTarget
Synonyms BNHS; iPLA2delta; LNMS; NTE; NTEMND; OMCS; SPG39; sws
ACCN NM_001166111
Insert Size 232 bp
Sequence Data
>SC202618 3’UTR clone of NM_001166111
The sequence shown below is from the reference sequence of NM_001166111. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGCCGCCCGGCTCAGCCACAGATGCCTGAGGACCTCGACAGGGGTCACCCCCTCCCTCCCACCCCTGG
ACTGGGCTGGGGGTGGCCCCGTGGGGGTAGCTCACTCCCCCTCCTGCTGCTATGCCTGTGACCCCCGCG
GCCCACACACTGGACTGACCTGCCCTGAGCGGGGATGCAGTGTTGCACTGATGACTTGACCAGCCCCTC
CCCCAATAAACTCGCCTCTTGGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001166111.2
Synonyms BNHS; iPLA2delta; LNMS; NTE; NTEMND; OMCS; SPG39; sws
Summary This gene encodes a phospholipase that deacetylates intracellular phosphatidylcholine to produce glycerophosphocholine. It is thought to function in neurite outgrowth and process elongation during neuronal differentiation. The protein is anchored to the cytoplasmic face of the endoplasmic reticulum in both neurons and non-neuronal cells. Mutations in this gene result in autosomal recessive spastic paraplegia, and the protein is the target for neurodegeneration induced by organophosphorus compounds and chemical warfare agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Locus ID 10908
MW 7.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...