Cyclin B3 (CCNB3) (NM_033670) Human 3' UTR Clone

CAT#: SC202598

3' UTR clone of cyclin B3 (CCNB3) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Cyclin B3 (CCNB3) (NM_033670) Human 3' UTR Clone
Vector pMirTarget
Synonyms CYCB3
ACCN NM_033670
Insert Size 241 bp
Sequence Data
>SC202598 3’UTR clone of NM_033670
The sequence shown below is from the reference sequence of NM_033670. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATTGTGAGGCTCAGGGCCTGGTACTCTAGCAGCAGCCACAGGGCTAAGCATGCATGTTAACAGGGTAT
ATTTATTCTATGTTCGAATTTGTCTTTTGATCGCTTTTATTCATTTTTCCTTTCTTTGTCTTTTCCCAA
ACTGATAATGTTATAAATATTTATGTTGCTTGTTTTTATGAAAGAAAAAATATTGTCATATTTGACTAC
AAATTTAATAAAAAATTAATGGTTATTGTTAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_033670.4
Synonyms CYCB3
Summary The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as positive regulators of cyclin-dependent kinases (CDKs), and thereby play an essential role in the control of the cell cycle. Different cyclins exhibit distinct expression and degradation patterns, which contribute to the temporal coordination of each mitotic event. Studies of similar genes in chicken and drosophila suggest that this cyclin may associate with CDC2 and CDK2 kinases, and may be required for proper spindle reorganization and restoration of the interphase nucleus. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Locus ID 85417
MW 9.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...