Fibrinogen alpha chain (FGA) (NM_021871) Human 3' UTR Clone

CAT#: SC202532

3' UTR clone of fibrinogen alpha chain (FGA) transcript variant alpha for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Fibrinogen alpha chain (FGA) (NM_021871) Human 3' UTR Clone
Vector pMirTarget
Synonyms Fib2
ACCN NM_021871
Insert Size 249 bp
Sequence Data
>SC202532 3’UTR clone of NM_021871
The sequence shown below is from the reference sequence of NM_021871. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTTTGGGGAAGCCTTCCCTGTCCCCCTAGACTAAGTTAAATATTTCTGCACAGTGTTCCCATGGCCCC
TTGCATTTCCTTCTTAACTCTCTGTTACACGTCATTGAAACTACACTTTTTTGGTCTGTTTTTGTGCTA
GACTGTAAGTTCCTTGGGGGCAGGGCCTTTGTCTGTCTCATCTCTGTATTCCCAAATGCCTAACAGTAC
AGAGCCATGACTCAATAAATACATGTTAAATGGATGAATGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_021871.4
Synonyms Fib2
Summary This gene encodes the alpha subunit of the coagulation factor fibrinogen, which is a component of the blood clot. Following vascular injury, the encoded preproprotein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mutations in this gene lead to several disorders, including dysfibrinogenemia, hypofibrinogenemia, afibrinogenemia and renal amyloidosis. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that undergoes proteolytic processing. [provided by RefSeq, Jan 2016]
Locus ID 2243
MW 9.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...