Cytokeratin 7 (KRT7) (NM_005556) Human 3' UTR Clone

CAT#: SC202509

3' UTR clone of keratin 7 (KRT7) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Cytokeratin 7 (KRT7) (NM_005556) Human 3' UTR Clone
Vector pMirTarget
Synonyms CK7; K2C7; K7; SCL
ACCN NM_005556
Insert Size 191 bp
Sequence Data
>SC202509 3’UTR clone of NM_005556
The sequence shown below is from the reference sequence of NM_005556. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCGCCAGTCGCAGGAGTGCCCGCGACTGAGCCGCCTCCCACCACTCCACTCCTCCAGCCACCACCCAC
AATCACAAGAAGATTCCCACCCCTGCCTCCCATGCCTGGTCCCAAGACAGTGAGACAGTCTGGAAAGTG
ATGTCAGAATAGCTTCCAATAAAGCAGCCTCATTCTGAGGCCTGAGTGATCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005556.4
Synonyms CK7; K2C7; K7; SCL
Summary The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the simple epithelia lining the cavities of the internal organs and in the gland ducts and blood vessels. The genes encoding the type II cytokeratins are clustered in a region of chromosome 12q12-q13. Alternative splicing may result in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
Locus ID 3855
MW 6.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...