ORC5L (ORC5) (NM_181747) Human 3' UTR Clone

CAT#: SC202502

3' UTR clone of origin recognition complex subunit 5-like (yeast) (ORC5L) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ORC5L (ORC5) (NM_181747) Human 3' UTR Clone
Vector pMirTarget
Synonyms ORC5L; ORC5P; ORC5T; PPP1R117
ACCN NM_181747
Insert Size 198 bp
Sequence Data
>SC202502 3' UTR clone of NM_181747
The sequence shown below is from the reference sequence of NM_181747. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTAAAGAGCATTCAGTCAGGAAATAGTGTTATAAAAGAGAATTTACTTTTCAAGCTATAATGCTATTTTG
ATTAATGATTTTTCTTTAACTGAAGCTCTAATTTAATGGGAGGAAATAAAAGTTTGAATACCAGCTTTCT
ATTTTCTAAATATTGGATTATATCATGAAAATCAAGCAGTTTCTATTTCTTTAAATGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_181747.1
Synonyms ORC5L; ORC5P; ORC5T; PPP1R117
Summary The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Oct 2010]
Locus ID 5001
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...