SOD2 (NM_001024465) Human 3' UTR Clone

CAT#: SC202445

3' UTR clone of superoxide dismutase 2 mitochondrial (SOD2) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SOD2 (NM_001024465) Human 3' UTR Clone
Vector pMirTarget
Synonyms GClnc1; IPO-B; IPOB; Mn-SOD; MNSOD; MVCD6
ACCN NM_001024465
Insert Size 284 bp
Sequence Data
>SC202445 3’UTR clone of NM_001024465
The sequence shown below is from the reference sequence of NM_001024465. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTGAAAGATACATGGCTTGCAAAAAGTAAACCACGATCGTTATGCTGATCATACCCTAATGATCCCAG
CAAGATAATGTCCTGTCTTCTAAGATGTGCATCAAGCCTGGTACATACTGAAAACCCTATAAGGTCCTG
GATAATTTTTGTTTGATTATTCATTGAAGAAACATTTATTTTCCAATTGTGTGAAGTTTTTGACTGTTA
ATAAAAGAATCTGTCAACCATCAAAGAGGTCTGCATTATGCTTGCATGTCAAAAACTTTAAAAATCCTA
TAATCTTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001024465.3
Synonyms GClnc1; IPO-B; IPOB; Mn-SOD; MNSOD; MVCD6
Summary This gene is a member of the iron/manganese superoxide dismutase family. It encodes a mitochondrial protein that forms a homotetramer and binds one manganese ion per subunit. This protein binds to the superoxide byproducts of oxidative phosphorylation and converts them to hydrogen peroxide and diatomic oxygen. Mutations in this gene have been associated with idiopathic cardiomyopathy (IDC), premature aging, sporadic motor neuron disease, and cancer. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 1. [provided by RefSeq, Apr 2016]
Locus ID 6648
MW 10.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...