CDK5 (NM_001164410) Human 3' UTR Clone

CAT#: SC202408

3' UTR clone of cyclin-dependent kinase 5 (CDK5) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CDK5 (NM_001164410) Human 3' UTR Clone
Vector pMirTarget
Synonyms LIS7; PSSALRE
ACCN NM_001164410
Insert Size 224 bp
Sequence Data
>SC202408 3’UTR clone of NM_001164410
The sequence shown below is from the reference sequence of NM_001164410. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCTACTTCTCCGACTTCTGTCCGCCCTAGGCCCCGGGACCCCCGGCCTCCAGGCTGGGGCCTGGCCTA
TTTAAGCCCCCTCTTGAGAGGGGTGAGACAGTGGGGGTGCCTGGTGCGCTGTGCTCCAGCAGTGCTGGG
CCCAGCCGGGGTGGGGTGCCTGAGCCCGAATTTCTCACTCCCTTTGTGGACTTTATTTAATTTCATAAA
TTGGCTCCTTTCCCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001164410.3
Synonyms LIS7; PSSALRE
Summary This gene encodes a proline-directed serine/threonine kinase that is a member of the cyclin-dependent kinase family of proteins. Unlike other members of the family, the protein encoded by this gene does not directly control cell cycle regulation. Instead the protein, which is predominantly expressed at high levels in mammalian postmitotic central nervous system neurons, functions in diverse processes such as synaptic plasticity and neuronal migration through phosphorylation of proteins required for cytoskeletal organization, endocytosis and exocytosis, and apoptosis. In humans, an allelic variant of the gene that results in undetectable levels of the protein has been associated with lethal autosomal recessive lissencephaly-7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
Locus ID 1020
MW 7.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...