PPIH (NM_006347) Human 3' UTR Clone

CAT#: SC202366

3' UTR clone of peptidylprolyl isomerase H (cyclophilin H) (PPIH) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PPIH (NM_006347) Human 3' UTR Clone
Vector pMirTarget
Synonyms CYP-20; CYPH; SnuCyp-20; USA-CYP
ACCN NM_006347
Insert Size 226 bp
Sequence Data
>SC202366 3’UTR clone of NM_006347
The sequence shown below is from the reference sequence of NM_006347. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGGTGATCTCGCAGTGTGGGGAGATGTAGTCCAGACAAAGACTGAATCAGGCCTTCCCTTCTTCTTGG
TGGTGTTCTTGAGTAAGATAATCTGGACTGGCCCCCGTCTTTGCTTCCCTGCCTGCTGCTGCCCCATTT
GATCAAGAGACCATGGAAGTGTCAGAGATTCAGAATCCAAGATTGTCTTTAAGTTTTCAACTGTAAATA
AAGTTTTTTTGTATGCGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006347.4
Synonyms CYP-20; CYPH; SnuCyp-20; USA-CYP
Summary The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein is a specific component of the complex that includes pre-mRNA processing factors PRPF3, PRPF4, and PRPF18, as well as U4/U5/U6 tri-snRNP. This protein has been shown to possess PPIase activity and may act as a protein chaperone that mediates the interactions between different proteins inside the spliceosome. [provided by RefSeq, Jul 2008]
Locus ID 10465
MW 8.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...