S100A1 (NM_006271) Human 3' UTR Clone

CAT#: SC202365

3' UTR clone of S100 calcium binding protein A1 (S100A1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name S100A1 (NM_006271) Human 3' UTR Clone
Vector pMirTarget
Synonyms S100; S100-alpha; S100A
ACCN NM_006271
Insert Size 228 bp
Sequence Data
>SC202365 3’UTR clone of NM_006271
The sequence shown below is from the reference sequence of NM_006271. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGTAACAATTTCTTCTGGGAGAACAGTTGAGCAGACAGCCACATTGGGCAGCGCCCTTCCTCTCCACCC
TCCCAGACCTGCCTCTTCCCCCTGCTTCCACCTCACCCCACTTATCCCTCTCCATAACCCCACCCTTGC
CCACCCCACCCCCACCCCCACCAAGGGCGCAAGAGTAGCGGTCCAAGCCTGCAACTCATCTTTCATTAA
AGGCTTCTCTCTCACCAGCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006271.2
Synonyms S100; S100-alpha; S100A
Summary The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphorylation. Reduced expression of this protein has been implicated in cardiomyopathies. [provided by RefSeq, Jul 2008]
Locus ID 6271
MW 8.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...