Pirin (PIR) (NM_001018109) Human 3' UTR Clone

CAT#: SC202320

3' UTR clone of pirin (iron-binding nuclear protein) (PIR) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Pirin (PIR) (NM_001018109) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_001018109
Insert Size 235 bp
Sequence Data
>SC202320 3’UTR clone of NM_001018109
The sequence shown below is from the reference sequence of NM_001018109. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAAACCTGGAAATCAAAGATTGGGAACTAGTGGAAAGCGGAAGAGCAGGTCTTGATGTGTCCTAGAATT
TTGCCATTTCTGAGATTGAGCCATTGAAGGCATTCCATTTCTAAAGCTTATTTAGCCGGTGCTTCTAAA
GAATTCCACACTAACGTGATAACATGGTTTTTGTAACAATAAATGTAGGATATTTCCTGGCACATGCAA
ATAAACCTAATCATTGTTTCTTTAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001018109.3
Summary This gene encodes a member of the cupin superfamily. The encoded protein is an Fe(II)-containing nuclear protein expressed in all tissues of the body and concentrated within dot-like subnuclear structures. Interactions with nuclear factor I/CCAAT box transcription factor as well as B cell lymphoma 3-encoded oncoprotein suggest the encoded protein may act as a transcriptional cofactor and be involved in the regulation of DNA transcription and replication. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
Locus ID 8544
MW 9.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...