TEM8 (ANTXR1) (NM_053034) Human 3' UTR Clone

CAT#: SC202313

3' UTR clone of anthrax toxin receptor 1 (ANTXR1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name TEM8 (ANTXR1) (NM_053034) Human 3' UTR Clone
Vector pMirTarget
Synonyms ATR; GAPO; TEM8
ACCN NM_053034
Insert Size 234 bp
Sequence Data
>SC202313 3’UTR clone of NM_053034
The sequence shown below is from the reference sequence of NM_053034. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGAGAGTGAGGAAAATAAAATAAAATAACAAGAAGAAGAAAGAAAGAAATCCCACAGAAACAGATAA
CCTAACACAGCCCGTGCAACGTATTTTATACAATGCTCTGAAAATCATAGTCTCAATCTAGACAGTCTT
TTCCTCTAGTTCCCTGTATTCAAATCCCAGTGTCTAACATTCAATAAATAGCTATATGAAATCAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_053034.2
Synonyms ATR; GAPO; TEM8
Summary This gene encodes a type I transmembrane protein and is a tumor-specific endothelial marker that has been implicated in colorectal cancer. The encoded protein has been shown to also be a docking protein or receptor for Bacillus anthracis toxin, the causative agent of the disease, anthrax. The binding of the protective antigen (PA) component, of the tripartite anthrax toxin, to this receptor protein mediates delivery of toxin components to the cytosol of cells. Once inside the cell, the other two components of anthrax toxin, edema factor (EF) and lethal factor (LF) disrupt normal cellular processes. Three alternatively spliced variants that encode different protein isoforms have been described. [provided by RefSeq, Oct 2008]
Locus ID 84168
MW 9.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...