NHEDC1 (SLC9B1) (NM_001100874) Human 3' UTR Clone

CAT#: SC202268

3' UTR clone of Na+/H+ exchanger domain containing 1 (NHEDC1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NHEDC1 (SLC9B1) (NM_001100874) Human 3' UTR Clone
Vector pMirTarget
Synonyms NHA1; NHEDC1
ACCN NM_001100874
Insert Size 221 bp
Sequence Data
>SC202268 3' UTR clone of NM_001100874
The sequence shown below is from the reference sequence of NM_001100874. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAGGTAGCCAAGAAGTGCGAGTACACCAAGGAAAGGCAATAACCGAAGCCATTCTGAAACTAAACATGTA
GATGTGTCAGAATCTGCAGTGCTCTTGGAAAAGAATTCAAAATAGCATGTCGTTTCATCCTTGAGCTTAT
TCTTTGTTACTTTTTACATTAATTCCTTTTTAATGGATCCATAAAACTGTGAATAAATAACACAATAAAG
CCAGCTCTACC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001100874.1
Synonyms NHA1; NHEDC1
Summary The protein encoded by this gene is a sodium/hydrogen exchanger and transmembrane protein. Highly conserved orthologs of this gene have been found in other mammalian species. The expression of this gene may be limited to testis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Locus ID 150159
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...