Haptoglobin (HP) (NM_001126102) Human 3' UTR Clone

CAT#: SC202160

3' UTR clone of haptoglobin (HP) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Haptoglobin (HP) (NM_001126102) Human 3' UTR Clone
Vector pMirTarget
Synonyms BP; HP2ALPHA2; HPA1S
ACCN NM_001126102
Insert Size 195 bp
Sequence Data
>SC202160 3’UTR clone of NM_001126102
The sequence shown below is from the reference sequence of NM_001126102. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGGTTCAGAAGACCATAGCTGAGAACTAATGCAAGGCTGGCCGGAAGCCCTTGCCTGAAAGCAAGATT
TCAGCCTGGAAGAGGGCAAAGTGGACGGGAGTGGACAGGAGTGGATGCGATAAGATGTGGTTTGAAGCT
GATGGGTGCCAGCCCTGCATTGCTGAGTCAATCAATAAAGAGCTTTCTTTTGACCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001126102.3
Synonyms BP; HP2ALPHA2; HPA1S
Summary This gene encodes a preproprotein, which is processed to yield both alpha and beta chains, which subsequently combine as a tetramer to produce haptoglobin. Haptoglobin functions to bind free plasma hemoglobin, which allows degradative enzymes to gain access to the hemoglobin, while at the same time preventing loss of iron through the kidneys and protecting the kidneys from damage by hemoglobin. Mutations in this gene and/or its regulatory regions cause ahaptoglobinemia or hypohaptoglobinemia. This gene has also been linked to diabetic nephropathy, the incidence of coronary artery disease in type 1 diabetes, Crohn's disease, inflammatory disease behavior, primary sclerosing cholangitis, susceptibility to idiopathic Parkinson's disease, and a reduced incidence of Plasmodium falciparum malaria. The protein encoded also exhibits antimicrobial activity against bacteria. A similar duplicated gene is located next to this gene on chromosome 16. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2014]
Locus ID 3240
MW 7.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...