Peroxiredoxin 5 (PRDX5) (NM_181651) Human 3' UTR Clone

CAT#: SC202121

3' UTR clone of peroxiredoxin 5 (PRDX5) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Peroxiredoxin 5 (PRDX5) (NM_181651) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACR1; AOEB166; B166; HEL-S-55; PLP; PMP20; PRDX6; prx-V; PRXV; SBBI10
ACCN NM_181651
Insert Size 150 bp
Sequence Data
>SC202121 3’UTR clone of NM_181651
The sequence shown below is from the reference sequence of NM_181651. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGCACCCAATATCATCTCACAGCTCTGAGGCCCTGGGCCAGATTACTTCCTCCACCCCTCCCTATCT
CACCTGCCCAGCCCTGTGCTGGGGCCCTGCAATTGGAATGTTGGCCAGATTTCTGCAATAAACACTTGT
GGTTTGCGGCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_181651.3
Synonyms ACR1; AOEB166; B166; HEL-S-55; PLP; PMP20; PRDX6; prx-V; PRXV; SBBI10
Summary This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein interacts with peroxisome receptor 1 and plays an antioxidant protective role in different tissues under normal conditions and during inflammatory processes. The use of alternate transcription start sites is thought to result in transcript variants that use different in-frame translational start codons to generate isoforms that are targeted to the mitochondrion (isoform L) or peroxisome/cytoplasm (isoform S). Multiple related pseudogenes have been defined for this gene. [provided by RefSeq, Nov 2017]
Locus ID 25824
MW 5.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...