Neuropeptide Y (NPY) (NM_000905) Human 3' UTR Clone

CAT#: SC202106

3' UTR clone of neuropeptide Y (NPY) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Neuropeptide Y (NPY) (NM_000905) Human 3' UTR Clone
Vector pMirTarget
Synonyms PYY4
ACCN NM_000905
Insert Size 205 bp
Sequence Data
>SC202106 3’UTR clone of NM_000905
The sequence shown below is from the reference sequence of NM_000905. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTCGGCTTGAAGACCCTGCAATGTGGTGATGGGAAATGAGACTTGCTCTCTGGCCTTTTCCTATTTTC
AGCCCATATTTCATCGTGTAAAACGAGAATCCACCCATCCTACCAATGCATGCAGCCACTGTGCTGAAT
TCTGCAATGTTTTCCTTTGTCATCATTGTATATATGTGTGTTTAAATAAAGTATCATGCATTCAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000905.4
Synonyms PYY4
Summary This gene encodes a neuropeptide that is widely expressed in the central nervous system and influences many physiological processes, including cortical excitability, stress response, food intake, circadian rhythms, and cardiovascular function. The neuropeptide functions through G protein-coupled receptors to inhibit adenylyl cyclase, activate mitogen-activated protein kinase (MAPK), regulate intracellular calcium levels, and activate potassium channels. A polymorphism in this gene resulting in a change of leucine 7 to proline in the signal peptide is associated with elevated cholesterol levels, higher alcohol consumption, and may be a risk factor for various metabolic and cardiovascular diseases. The protein also exhibits antimicrobial activity against bacteria and fungi. [provided by RefSeq, Oct 2014]
Locus ID 4852
MW 8.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...